Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Nature nanotechnology

Article Title: Immunological conversion of solid tumours using a bispecific nanobioconjugate for cancer immunotherapy

doi: 10.1038/s41565-022-01245-7

Figure Lengend Snippet: a, Schematic of the nanoparticle-based conversion strategy via anti-HER2 antibody targeting and SLAMF7 labeling of HER2-expressing cancer cells. b, Size distribution of unconjugated PEG-PLGA nanoparticles (NPs) and BiTNHER measured by dynamic light scattering. The increased size indicated the successful conjugation of antibody/protein onto the NP surface. c, Gel electrophoresis of unconjugated NP and NP conjugated with anti-HER2 antibody (HER-NP), SLAMF7 (S-NP), and both (BiTNHER). Experiment was repeated twice with similar results between repeats. d, HER-NP labeling of the HER2-expressing human breast cancer cell line SK-BR-3. (Left) Confocal images of HER2low MDA-MB-468 cells and HER2high SK-BR-3 cells after incubation with IgG-NP or HER-NP. Green, NPs; blue, DAPI (scale bar, 50 μm). (Right) FACS semiquantitative analysis of binding. e, BiTNHER labeling of HER2-expressing SK-BR-3 cells with SLAMF7. (Left) Confocal images of HER2low MDA-MB-468 cells and HER2high SK-BR-3 cells after incubation with IgG-SLAMF7-NP or HER-SLAMF7-NP. Cells were stained with anti-SLAMF7 antibody and anti-human IgG antibody (scale bar, 50 μm). Higher-magnification image of SK-BR-3 cells in the outlined area (scale bar, 20 μm). (Right) FACS semiquantitative analysis of binding. f, Binding affinity of nanoparticles with different HER:SLAMF7 conjugation ratios to HER2-expressing SK-BR-3 cells. The dissociation constant Kd increased when the conjugation ratio of anti-HER2 antibody decreased.

Article Snippet: To synthesise conjugated NPs, amine-reactive polymers were directly added into and reacted with PBS solution containing anti-HER2 antibodies (the human monoclonal anti-HER2 antibody trastuzumab from Genentech or the mouse monoclonal anti-HER2/neu antibody clone 7.16.4 from BioXcell), or recombinant SLAMF7 (human recombinant SLAMF7 from MyBioSource #MBS1458102, or mouse recombinant SLAMF7 from Genscript (Lot# U870KEL260-5)).

Techniques: Labeling, Expressing, Conjugation Assay, Nucleic Acid Electrophoresis, Incubation, Binding Assay, Staining

Journal: Nature nanotechnology

Article Title: Immunological conversion of solid tumours using a bispecific nanobioconjugate for cancer immunotherapy

doi: 10.1038/s41565-022-01245-7

Figure Lengend Snippet: a, BiTNHER with a 3:1 SLAMF7:HER conjugation ratio had the maximum pro-phagocytosis effect of human THP-1 against HER2-expressing SK-BR-3 cancer cells in the presence of aCD47 (n=3). b, BiTNHER converted HER2/neu-expressing human (SK-BR-3) and mouse (EO771/E2) breast cancer cells into SLAMF7high cells and promoted human THP-1 or mouse (C57BL6 bone marrow) macrophage phagocytosis in the presence of aCD47, comparable with the SLAMF7-expressing mouse leukemia L1210 cells (n=3). c, Anti-SLAMF7 antibody abrogated the pro-phagocytosis effect of BiTNHER and aCD47 on HER2-expressing cancer cells (n=3). d, Phagocytosis of CFSE-labelled HER2low EO771 and HER2high EO771/E2 mouse breast cancer cells and SLAMF7high L1210 mouse leukemia cells by mouse bone marrow macrophages in the presence of aCD47 after treatment with NP alone, NP with unconjugated anti-HER2 antibody and SLAMF7, or BiTNHER. Red, macrophages; green, cancer cells (scale bar, 50 μm). e, BiTNHER with aCD47 promotes macrophage phagocytosis against HER2-expressing breast cancer cells. f, Macrophages had increased antigen presentation of the H2kb-SIINFEKL complex after phagocytosis of BiTNHER -treated HER2-expressing EO771/E2-cOVA cells. Green, macrophages; red, H2kb-SIINFEKL complex (scale bar, 50 μm). g, Combination of BiTNHER and aCD47 increased macrophage antigen presentation of HER2-expressing cancer cells (n=4). h,i, BiTNHER with aCD47 promoted the priming of cOVA antigen-specific T cells (left) and induced a shift in naive T cells towards memory T cells (right) (n=4). For all figures, data are presented as mean±s.e.m.; **P<0.01, ***P<0.001, and ****P<0.0001 by one-way ANOVA with a Bonferroni post hoc correction. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by unpaired Student’s t-test for the indicated comparisons; n.s., not significant.

Article Snippet: To synthesise conjugated NPs, amine-reactive polymers were directly added into and reacted with PBS solution containing anti-HER2 antibodies (the human monoclonal anti-HER2 antibody trastuzumab from Genentech or the mouse monoclonal anti-HER2/neu antibody clone 7.16.4 from BioXcell), or recombinant SLAMF7 (human recombinant SLAMF7 from MyBioSource #MBS1458102, or mouse recombinant SLAMF7 from Genscript (Lot# U870KEL260-5)).

Techniques: Conjugation Assay, Expressing